07-09-2016
Mathematics

contestada

What is equivalent to 9/10

Respuesta :

Lizzy190 Lizzy190

07-09-2016

9/10 = 18/20

3/4 = 6/8

2/7 is a fraction between 1/3 and 1/4

Answer Link

Аноним Аноним

07-09-2016

18/20, 36/40, .9 all of these numbers are equivalent.

Answer Link

Otras preguntas

Question 10 of 10 PLEASE PLEASE HELP ME Which of the following will form the composite function GFX)) shown below? GFX)) = 3(x+1) A. Fx) = x2 and GCX) = 3x + 1

A tourism website claims travelers can see Europe for $75 a day. If a tourist saved $1,875 for a vacation, how many days can he spend in Europe?

What internal domestic challenges were posted by this new Cold War and its best military spending according to President Eisenhower?

list any two things that may include in an appendix of a long essay

Find the area of the following composite figures

Source: John L. O'Sullivan, "Annexation, The United States Magazine and Democratic Review, Vol. XVII, July, 1845 Note: Considered the first person to use the te

Help I'm taking a test, thx!

2. Tell whether the segment lengths form an acute, right, or obtuse? 9, 12, 17

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

The information in this source gives readers a better understanding of how Lincoln began his career in politics. why Lincoln wanted to become a lawyer. what i