jls7281 jls7281

08-01-2021
Biology

contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer mathsbeginer

12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

If the property tax on a $92000 home is $3,430, what is the tax on a $220,000 home?

A 60 kg runner in a sprint moves at 11 m/s. A 60 kg cheetah in a sprint moves at 33 m/s. By what factor does the kinetic energy of the cheetah exceed that of th

A rectangle has a length of 5 inches and a width of x inches. Write an equation to represent the perimeter of the rectangle. Explain your reasoning.

What kind of reasoning is used in the following statement? Because the crime-reduction policy I propose has worked successfully in New York, Houston, and New Or

Problem1 The behavior of a physical system can be described by the following first order differential equation: dy/dt=2y +t^2

Which treatment would most likely be used for cancer? angioplasty radiation pacemaker exercise :/

I Need The Answer Plz!! Geometry Is Hard!!

Find the area of a parallelogram if the angle between two of the sides is 120 degrees and the two sides are 15 inches and 12 inches in length.

Was Britain truly depriving colonists of their natural rights? Explain your reasoning.

Each chef at "Sushi Emperor" prepares 15 regular rolls and 20 vegetarian rolls daily. On Tuesday, each customer ate 2 regular rolls and 3 vegetarian rolls. By t