Justiiiin Justiiiin

12-02-2021
Geography

contestada

what was the first step on Haiti’s road to independence

Respuesta :

Аноним Аноним

17-02-2021

Answer:

The first step was for the slaves to revolt.

Explanation:

Why did creoles refuse to support Hidalgo or Morelos? They refused because they felt their politics would reduce their power.

Answer Link

Otras preguntas

in fig. 12-35, horizontal scaf- fold 2, with uniform mass m2 30.0 kg and length l2 2.00 m, hangs from horizontal scaffold 1, with uni- form mass m1 50.0 kg. a 2

Suppose your waiting time for a bus in the morning is uniformly distributed on [0, 12], whereas waiting time in the evening is uniformly distributed on [0, 14]

Which of the following statements are true for a square? (i) It is a rectangle. (ii) It has all its sides of equal length (iii)Its diagonals bisect each other a

[true of false] consider sending a tcp segment from a host in 172.16.1/24 to a host in 172.16.2/24. suppose the acknowledgment for this segment gets lost, so th

Lengths of pregnancies of women are normally distributed with a mean of 266 days and a standard deviation of 16 days. What percentage to the nearest hundredth o

the interpretation of the slope is different in a multiple linear regression model as compared to a simple linear regression model. t or f

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

A recent drug survey showed an increase in the use of drugs and alcohol among local high school seniors as compared to the national percent. Suppose that a surv

A newly discovered gas, gas Q, travels 3.40 times faster than carbon dioxide. What is the molar mass of gas Q?

You sample the solid waste of three infants from three different families each week for 24 weeks. You find that the population of bacteria in the gut is dominat