weissjen4855 weissjen4855

10-03-2021
Biology

contestada

If a primary strand of DNA is CGT AAGCTC, the complementary strand would be:

Respuesta :

janellyxoxo janellyxoxo

10-03-2021

Answer:

Between A and T there are two hydrogen bonds, while there are three between C and G. Right: two complementary strands of DNA.

...

DNA and RNA base pair complementarity.

Explanation:

adenine(A), thymine(T), guanine(G), cytosine(C) A=T, G≡C

Answer Link

Otras preguntas

Which expression is equivalent to 27 + 45?8(3 + 6)8(19 + 37)9(3 + 5)9(18+ 36)

Jayne's age can be written s the product of three different prime factors. which number could be Jayne's age

How do we interact with the government daily?

A 1.5 kg orange falls from a tree and hits the ground in 0.75s. What is the speed of the orange just before it hits the ground?

In a society that had made political participation a core element of freedom, ____________ became central to the former slaves' desire for empowerment and equal

Ferns spread spores instead of seeds, and some ferns eject the spores at surprisingly high speeds. One species accelerates 1.4 μg spores to a 4.5 m/s ejection s

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

Western Company is preparing a cash budget for June. The company has $12,000 in cash at the beginning of June and anticipates $30,000 in cash receipts and $34,5

Read the scenario and answer the question that follows: Sarah has always dreamed of dancing on stage with the New York City Ballet. Her mom tells her to set mor

Municipalities would issue tax exempt commercial paper for all of the following reasons EXCEPT to: A meet a temporary cash shortage due to unforeseen extraordin