tcolbert16owlbjn tcolbert16owlbjn

11-01-2018
Physics

contestada

Ninety percent of research animals are __________.

A. dogs
B. rats and mice
C. primates
D. rabbits

The answer is B

Respuesta :

Flowerly Flowerly

11-01-2018

Hey there!

I agree with you, the answer is B. :)

Hope this helps!
Have a great day!

Answer Link

Аноним Аноним

11-01-2018

Hey!

The correct answer is B.

Hope this helps! :D

Answer Link

Otras preguntas

Let X denote the time in minutes (rounded to the nearest half minute) for a blood sample to be taken. The probability mass function for X is:

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha

Alex is planning to surround his pool ABCD with a single line of tiles. How many units of tile will he need to surround his pool? Round your answer to the neare

What is the greatest common factor of 8x and 4y?

HELPPP PLEASE!!!!!!!!!!

How did nikita khrushchev’s tenure as a leader of the soviet union differ from leonid brezhnev’s? Place each idea into the correct category

Which sentence is written in the conditional mood? Why can't you go to the game tonight? If I can sing well enough, I'll join the school chorus. You have a toug

Help,anyone can help me do quetion,I will mark brainlest.

How can communities and governments help people when they may not have jobs, food, or homes?

Luis's bowling scores were 195, 194, 191, 190, 238, and 192. Which measure (median, mean, mode or range) BEST describes Luis's bowling score? EXPLAIN your answe